pUC/M13 Primer, Reverse (17mer), 2 µg, Promega

Supplier: Promega
Q5401
PAQ5401EA 121.15 USD
PAQ5401
pUC/M13 Primer, Reverse (17mer), 2 µg, Promega
Nucleic Acid Reagents Primers and Probes
Designed for sequencing inserts cloned into the M13 vectors and pUC plasmids. They also can be used for sequencing other lacZ-containing plasmids such as the pGEM-Z and pGEM-Zf Vectors.

  • Designed for Sequencing Inserts Cloned into the M13 Vectors and pUC Plasmids
  • Can sequence other lacZ-containing plasmids such as the pGEM(R)-Z and pGEM(R)-Zf Vectors
  • Supplied at a concentration of 10microg/ml

The pUC/M13 Primers are designed for sequencing inserts cloned into the M13 vectors and pUC plasmids. These primers also can be used for sequencing other lacZ-containing plasmids such as the pGEM-Z and pGEM-Zf Vectors. The primers are purified by gel electrophoresis or HPLC. Primer Sequences: [Forward (17mer)] 5'-d(GTTTTCCCAGTCACGAC)-3', [Reverse (17mer)] 5'-d(CAGGAAACAGCTATGAC)-3', [Reverse (22mer)] 5'-d(TCACACAGGAAACAGCTATGAC)-3', [Forward (24mer)] 5'-d(CGCCAGGGTTTTCCCAGTCACGAC)-3'.
Order Now

Learn more

About VWR

Avantor is a vertically integrated, global supplier of discovery-to-delivery solutions for...

Learn more About VWR